Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0823
Clone ID AM0823
Vector pGT0lxr
Project sanger

Sequence tag AM0823
Sequence
TTGTGAGCTCTTCTAGATGGTTTTTTTTATTTCGTTTTNTTCGTAAAGGTTATTCTGTTAGACATTACACTGGAGCTTCA
GAAGCAGATCATGTCTGAGCTGGAAATCCTTTATAAGTGTGACTCATCGTATATCATAGGATTTTACGGGGCATTTTTTG
TAGAAAACAGGATTTCAATTTGTACTGATTTCATGGATGGGGGGTCTTTGGTTGTTTATAGGAAAATTCCAGAGCATTTT
GGTGGGAGATTTTTAGAAGGGGTTTTTTTTTTTCTTATTTTCTTTTTTCTTTTATTGGATTTTACACAGAGATGTGAAGC
CCTCCAACATGCTTGTAAACACAGGCGGACAGGTCAAGCTGTGTGACTTTGGCGTGAGCACACAGCTGGTGAATTCTATA
GCCAAGACGTATGTTGGAACAAATGCTTACATGGCACCAGAAAGAATTTCAGGAGAGCAGTATGGGATCCATTCTGACGT
GTGGAGCTTAGGAATCTCTTTCATGGAG
Sequence Type mRNA
Unitrap ID UNI4155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63104784..63141573 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058444 (Map2k5) NM_011840 mitogen-activated protein kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346345]

 
Come back to gene ENSMUSG00000058444


For any suggestions or comments, please send an email to unitrap@crg.es