Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0798
Clone ID AM0798
Vector pGT0lxr
Project sanger

Sequence tag AM0798
Sequence
CACATTTGCCTATCCGGAAAGCAACAGCAGAGCCATATTTTCTGCTCTTAAGAATCTTCAAGATAAGATTCGACGCCTGG
AACTGGAAAGGATTCAGGCAGAAGAAAGTGTGAAAACCTTGTCTAGGGAAACCATTGAGTACAAGAAAGTATTGGATGAA
CAGATCCAAGAGAGGGAGAACTCAAAGAATGAAGAATCAAAGCACAATCAAGAACTGGCATCCCAGTTGGTAGCTGCAGA
AAATAAATGTAATCTTCTAGAAAAACAATTGGAATACATGCGAAATATGATAAAGCATGCAGAAATGGAGAGGACATCTG
TGTTAGAAAAGCAGGTTTCTCTAGAAAGAGAACGGCAGCATGATCAAACCCATGTTCAGAGCCAGCTGGAAAAACGTGGA
TCTGTCTTGAACAGGAATACAACAAACTCACCGCCATGCAGCCCCAAGCAGAAAAAAAGTATGCAGGATGTTGGAGTCCA
AACTCCGTGAAGAAGAGCAGGAAAGGAAGCGGATGCAGGCCCGTGCAGCAGAG
Sequence Type mRNA
Unitrap ID UNI4161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13620499..13626002 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031922 (Cep57) NP_080941 centrosomal protein 57 Gene [Source:MGI Symbol;Acc:MGI:1915551]

 
Come back to gene ENSMUSG00000031922


For any suggestions or comments, please send an email to unitrap@crg.es