Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0795
Clone ID AM0795
Vector pGT0lxr
Project sanger

Sequence tag AM0795
Sequence
TATCAAAGCAGGAAATATCCTTCTGACAGAACCAGGCCAAGTGAAACTTGCTGACTTTGGATCTGCTTGCATGGCTTCCC
CTGCCAATTCTTTTGTGGGAACACCATATTGGATGGCCCCAGAAGTAATTTTAGCCATGGATGAAGGACAGTATGATGGC
AAAGTTGATGTATGGTCTCTTGGAATAACGTGTATTGAATTAGCCGAGAGGAAGCCTCCTTTATTTAATATGAATGCAAT
GAGTGCCTTATATCACATAGCCCAAAATGAATCCCCTACACTTCAATATAATGAATGGTCTGATTATTTTCGAATCGTTG
TAGATTCTTGCCTCCAGAAAATCCCTCAAGATCGCCCTACATCAGAGGAACTTTTAAAG
Sequence Type mRNA
Unitrap ID UNI4162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77377166..77387308 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es