Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST356038
Clone ID OST356038
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST356038
Sequence
TGAGCCTCCTGTACCCTGGGTCCCCTTGACCAGAAGTTCAGTTGGGAGCAGCTTTCAGAGCTGGAGGCATACTTCAAGGT
GGAACCATACCCAGACCTCCAGGATCGAAAGATCATGGCCACCAGACTGAAACTGAAAGAGGAACAAGTTGAGGCTTGGT
TCATCCAGAGATCCTTGGAGGAGGAGATGCCGGCCCCCCTTGGCCAGGCTGCAGCAGTCTGCCCTGGATGGTACCTCTTC
TCCTTCCCACAAAGCCCTGTGCTGCAGGCCACCAAGCTGGAAGTACAGGCTCATTCCCATCAATCCCCCTGAGTCCTCGA
CCAGCTGCTTAAAGGATAGCAAAACTGTATTAATTTCAAAGACGGAGTTGACCGATGAGCAGTTCCAGAAGCTAAGAAAG
CACTTCGAGACAGACCGTTGCCCTAATGAGGAAACTCTGCAGGCCTTTGCTGAGGAACTCAAACTACGGAAAGACCTCAT
CAGATCCTGGTTCATCACTCAGCG
Sequence Type mRNA
Unitrap ID UNI20639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16482751..16489068 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074365 (Crxos1) NM_001033638 Crx opposite strand transcript 1 Gene [Source:MGI (curated);Acc:Crxos1-001]

 
Come back to gene ENSMUSG00000074365


For any suggestions or comments, please send an email to unitrap@crg.es