Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0610
Clone ID AM0610
Vector pGT0lxr
Project sanger

Sequence tag AM0610
Sequence
TTGTGAGCTCTTCTAGATGGCAGCGCTGAATGTGCGAGACAATGTTGGGGAAGAAGTGGACGCAGAGCAGTTGATTCAGG
AGGCCTGCCGCAGCTGCCTGGAGCAGGCAAAGCTGCTCTTTTCTGATGGAGAGAAAGTGATACCCAGATTGGCCCATGAG
CTTCCAGGGATCAAGCGGGGCCGGCAAGCAGAAGAGGAGTCCCACCGAGGAAGCCCCATTCCCAAAAAGAGGAAAGGTCG
GCCTCCTGGACACGTCCTGTCAAATGACCGCGCAGCTGCTGGCATGGTATGGAAACAAAAATCCTGTGTGCCAATTAGCT
CGAGAAGGCCCCAAGTGGGACCCAGCTCGGCTGAATGAATCTACCACCTTTGTTTTGGGGTCTCGAGCCAACAAGGCCTT
GGGGATGGGAGGCACCAGAGGGAGAATTGGTTGCGAGGTATTCTAGATGGTTTAAG
Sequence Type mRNA
Unitrap ID UNI4179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164579608..164588753 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es