Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0569
Clone ID AM0569
Vector pGT0lxr
Project sanger

Sequence tag AM0569
Sequence
CTAGATGGGACCAAGAAGAAAAAGGAGAAGATGGTGAGCGCAGCTTTTATGAAGAAGTACATTCACGTGGCCAAAATTAT
CAAGCCCACCCTGACACAGGAGTCAGCAGCCTACATTGCAGAAGAATACTCACGCCTGCGCAGCCAGGACAGTATGAGCT
CAGACACTGCCCGGACATCTCCAGTTACAGCACGGACACTGGAAACTCTGATTCGACTGGCCACGGCCCATGCGAAGGCC
CGGATGAGCAAGACTGTGGACCTGCAGGATGCAGAGGAAGCCGTGGAGCTGGTTCAGTATGCTTATTTCAAGAAGGTTCT
GGAGAAGGAGAAGAAACGTAAGAAGGCAAGTGAGGATGAATCAGACCTAGAAGATGAAGAGGAAAAGAGCCAGGAAGACA
CTGAGCAGAAGCGGAAAAGGAGGAAGACTCATGCCAAGGATGGAGAGTCCTATGACCCTTACGACTTCAGTGAAGCAGAG
ACGCAGATGCCTCAAG
Sequence Type mRNA
Unitrap ID UNI4182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 20795344..20799699 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041859 (Mcm3) NM_008563 minichromosome maintenance deficient 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101845]

 
Come back to gene ENSMUSG00000041859


For any suggestions or comments, please send an email to unitrap@crg.es