Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST355228
Clone ID OST355228
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST355228
Sequence
ACTGAGATAATTAGCACCATGGAGCCTCAGGTGTCAAATGGACCGACATCCAATACAAGCAATGGACCCTCCAGCAACAA
CAGAAACTGTCCTTCTCCCATGCAGACAGGCGCCGCCACAGATGACAGCAAAACCAACCTCATCGTCAACATATTTACCC
CAGAATATGACCCAAGAGGAATTCAGGAGTCTCTTTGGGAGCATTGGTGAAATAGAATCCTGCAAACTCGTGAGAGACAA
AATCACAGGACAGAGTTTAGGGTATGGATTTGTTAACTATATTGATCCAAAGGATGCANAGAAAGCCATCANCACTTTAN
ATGGACTCAGACTCCAGACCAAAACCATAAAGGTGCC
Sequence Type mRNA
Unitrap ID UNI20666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109899148..109924128 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028546 (Elavl4) NM_010488 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene [Source:MGI (curated);Acc:Elavl4-001]

 
Come back to gene ENSMUSG00000028546


For any suggestions or comments, please send an email to unitrap@crg.es