Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST355105
Clone ID OST355105
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST355105
Sequence
TGAAATAGTTGCGTAAATATGACAGAGGGCAGGGAAGGTGCAGAGATCGAGCCCTGGGAAGATGCTGATTATCTTGTTTA
CAAAGTCACCGATAGATTTGGCTTTTTACATGAGGAGGAGCTCCCATACCATAATGCAGCTGCGGACCGGCAAAAGCAAC
TGGAAATCTGAAAGGACTTCCAAGTGGCTGAAAATGCTGAAAAAATGGGAGAGATACAAGAACACCGAGAAGAAATCACA
GNGAAATGAAAGGCGACATGTGTCCATCCTTGGAAAATGGNTTNGGCCTTATGCCTTGCAAACCACTGACATCTCACCTT
CACATGAGTGATCTTCACAGACGTAATAAAGGTGGCTCTGCATCTAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6315517..6331174 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039046 (Usp6nl) NM_181399 USP6 N-terminal like Gene [Source:MGI (curated);Acc:Usp6nl-001]

 
Come back to gene ENSMUSG00000039046


For any suggestions or comments, please send an email to unitrap@crg.es