Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST354922
Clone ID OST354922
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST354922
Sequence
GACTTATCTGGCTCTACTGATGGCGAGCAACTCNANANGGAACCCGACTTNTTNCAGGAAGACGAAGAGGAAGCGATGAC
ATTGGCCCTACCTGAGGGACCCCAGGAGTTAGACATGGACAGTCCCATGGAGAGCAGCCAAGGCCCGGAGGGCTCTGTCA
AGGGTTGTGGCGAGGAGAAGGAGCCTGAGCTGGCGGGCCTGTTCCTGCCAGAGGACAAGTGCCTCGTCCTCACTCCATCT
GTGACCACATCAGACCTTTCCACTCACTCCACCGCCTCTCTTATCAGCAACGAGGAGCAATTTGAAGACTATGGCGAGGG
GGATGACGTGGACTGTGCTCCCAGCAGCCCATGCCCCGACGATGAGACCAGAACCA
Sequence Type mRNA
Unitrap ID UNI20684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79494296..79497000 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es