Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0224
Clone ID AM0224
Vector pGT0lxr
Project sanger

Sequence tag AM0224
Sequence
GGGGGTTGTGAGCTTTTNGAGAGGGGGGTTGTGAGCTTTTCNAGATGGTGGTTGTGAGCTCTTCTAGATGGTTTTTTTTT
GTTCACTTTGGAGGATGGGTTGACCTGGCTGTGGCAGAGTTACTGCTGAGGGAGGAAGCTGAGCCTCCTGCTGGCCTGCT
GTGGCTCTTGGTGTTCTATTACAGCCCACAGGATGGGAGTCAGCAGAGAGAGCAGAGCATGGTGGAGCTGAAGGTATTAA
TCAACCGTCTCCTGATGCTGCTCAGAAGCGGCCCCCTCTCAGCTACTGATCTGCAGGAAGCAGCTGAGAGTCCCAGTGGA
GACCCCAGACCACCTGTATGTGGACAGCTGGTCAGACGCCTTCTTCTTAGTCTCTTGCTCTGGACCCCAGAAGGCCATGC
AATTGTCTGGGAAGCTGTCACCCAT
Sequence Type mRNA
Unitrap ID UNI4189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63418661..63423330 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021461 (Fancc) NM_007985 Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]

 
Come back to gene ENSMUSG00000021461


For any suggestions or comments, please send an email to unitrap@crg.es