Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST354814
Clone ID OST354814
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST354814
Sequence
AGAACCACAGATGCATGCAATGGCCAGAGAAGCCCGTGCTTCACTACTTCAATGCCCGGGGCAGAATGGAGTGCATCAGG
TGGCTCCTGGCTGCAGCAGGGGTGGAGTTTGAAGAGAAGNTTATACAGAGTCCGGAAGATT
Sequence Type mRNA
Unitrap ID UNI20690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78080030..78082924 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074183 (Gsta1) NM_008181 glutathione S-transferase, alpha 1 (Ya) Gene [Source:MGI (curated);Acc:Gsta1-001]

 
Come back to gene ENSMUSG00000074183


For any suggestions or comments, please send an email to unitrap@crg.es