Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST354468
Clone ID OST354468
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST354468
Sequence
GACTGAGGTGGCGCTTGCNTGCATACGCCATGCTGCTACAGCCCAACAGGGCCGNCGGCTATAGGATTCCCTTCAACAGT
CACGAGGGTGGCTGCGGGGCTGCCATGCGCGCCATGTGCATCGGGCTGAGGTTCCCCCACCCCAGCCAACTGGATCTGCT
GATCCAAGTGAGCATCGAGAGCTGGCCGGATGACCCACCACCACCCCACGGGCTACCTCGNCAGCCTTGCGTCCGCTCTT
TTTACGGCATATGCCGTGAATGGCAAGTCACCATGGCAGTGGNGAAAAGGGCTAATGGAGGTGCTGCCTGAAGCCAAAAA
GTACATCACTCAGTCAGGCTACTTTGTGAAGGAGAATCTTCAACACTGGTCCTACTTCGAGAAAGAATGGGAAAAGTACC
TGGAGCTTAGAGGAATTTTGGACGGCAACTCGGCTCCCGTCTTCCCGCANCCCTTTGNTGTGAAGGAAAGGGATCAGTTC
TACATCGACGTGAGCTACTCGGGCTGGGGTGGCAGCAGCGG
Sequence Type mRNA
Unitrap ID UNI20699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38446032..38447690 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]

 
Come back to gene ENSMUSG00000002844


For any suggestions or comments, please send an email to unitrap@crg.es