Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0662
Clone ID AL0662
Vector pGT0lxr
Project sanger

Sequence tag AL0662
Sequence
CGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGGGACCGCGTATCAGAGCTTTGAGCAGGT
AGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCTCTTTTGGCGGGGCACTGTGCGTGG
AAAGCGTAGTACAAGGAGGATGCAGGTATTGGTGAGTCGGATTGCAAGTTGGATGGCCACCTATCTGAATGACCACCTAG
AGCCTTGGATCCAGGAGAACGGCGGCTGGGTCCT
Sequence Type mRNA
Unitrap ID UNI3494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152655161..152655429 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es