Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353995
Clone ID OST353995
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353995
Sequence
TGAGGGAGATATCTGCCCTCCAAGAGCAGCTGCTGAGCTCTGAGGCCACAGTTCGCAGCCTGCAGGCCGCAGTGGACCAG
AGGGACCAGATGATCCAGCAGCTACAGCCTCGGGCTGACCTGCTGCAGGACATCACTCGCCACCGACCACCCCTGGCCGC
ACTGTTGGCCACCCTGGAGGAGGCAGAGGAACTGGGCCCCTTGCCGGCCAGCCACAGCCATAGGGCCCAGCTACTTCCTG
ATGGGCCTGGCCCACCCCTGGGCAACAACATGGGAAAGGAGGAGGGCCAGGACGACCAGGACGACCAGCAGCCTGCTGTG
TTTGGGACCACGGTGTGAGCTGTCCTGACAGATCTCAGAATCTGTGGTCACGGCCCCATGGGGATTCCACTCTTAGAGTC
CTGGACATCACCTAGAGGGGTCTTGAGACATTACCCGGATCCCATCTAAACATCACAACAAGTGAAAACTCAAGATCTCA
TTTAAACCCCCCCCCCCCCCCC
Sequence Type mRNA
Unitrap ID UNI20711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56854743..56855242 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054723 (AI662250) NM_178926 Vimentin-type intermediate filament-associated coiled-coil protein [Source:UniProtKB/Swiss-Prot;Acc:Q8BP01]

 
Come back to gene ENSMUSG00000054723


For any suggestions or comments, please send an email to unitrap@crg.es