Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353628
Clone ID OST353628
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353628
Sequence
CCGAGCATAAGCTTGCTTTCAAACCTGAAGATACTCGGGCTCACAGGAAATGACCTTTTGTCCTTCCCAGAGGAAATCTT
TTNCTTAATATCTCTGGAGAAATTATATATTGGACAAGACCAGGGGTCCAAGCTTTCATCTTTGCCAGANAACATCAAGA
GATTGATGATTTGNGAGAGCNTGGTNATGGAAGACAACNTTACTCTGNTGCCTNCCAGAGAACCTTGATCNCNTGGCNAA
TNTTANGGGNCTNACACTGANGAACAACCCCATGGACGNCCCTCCCATATANGNGTGTNNCCAAGGNNATGAAGCCATAT
GGACNCACCTGAGGGAGAACAGAATTAGGANNATGANGGCCACCACGATNCAGGCATGGTGNCGNGGAATCATGGCCCGN
NAAGGATNTNGATCTTANGACNAGCTACTAAGNGCCCGANNAANNGGNGNATCCCCTNCAAAGGACNCGAAAGGGANACA
GGCTGCAAAGGGGAAGCCTCAT
Sequence Type mRNA
Unitrap ID UNI20725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30554565..30571194 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027703 (Lrriq4) NM_026668 leucine-rich repeats and IQ motif containing 4 Gene [Source:MGI Symbol;Acc:MGI:1915557]

 
Come back to gene ENSMUSG00000027703


For any suggestions or comments, please send an email to unitrap@crg.es