Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0039
Clone ID AL0039
Vector pGT0lxr
Project sanger

Sequence tag AL0039
Sequence
GGTTGTGAGTTTTTTTAGATGGTTTTGGTTGTGAGCTTTTCTAGATGGTTTTGGTTGTGAGCTCTTCTAGATGGTTGTTC
ACAAGGACCCGCCTGATAAGCCAACCGTGAGCCAGTTTACAAGATTCCTTTGCAGCTCACCATTGGAGGCAGAGCACCCT
GCTGATGGACCAGAATGTGGTTATGGCTCCTTTCACCAGCAGTACTGGCTCGATGGGAAGATCATTGCTGTGGGGGTGTT
AGACATTCTCCCGTACTGTGTGTCTTCTGTGTATCTCTACTACGATCCTGATTATTCATTTCTGTCTTTGGGTGTCTATT
CAGCATTAAGAGAAATTGCTTTTACTAGACAACTGCATGAGAAAACATCGCAACTCAGCTATTATTATATGGGTTTCTAC
ATTCATTCCTGTCCCAAGATGAGATACAAG
Sequence Type mRNA
Unitrap ID UNI4228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137607645..137648259 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030850 (Ate1) NM_001029895 arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

 
Come back to gene ENSMUSG00000030850


For any suggestions or comments, please send an email to unitrap@crg.es