Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353348
Clone ID OST353348
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353348
Sequence
ACAGGCCTCTGTCCTTGCTGAAGAAGAAGGACCCTTGAATTTACCAGAAAGATGCTACCNTTCTATCAGAGAACAGCCGA
AGCCTCATCTTCAGAGAGTGAGGAGGAGCCGCCAGCAGCCTTGGGGAAGCAGGAGAAGCAGCAGAAGCAGCAGCCCATGT
ACCTGAAGGACTATGAGAGGAAGGTCATCTTGGAGAAAGGAGGCAAATATGTGGACGAGAA
Sequence Type mRNA
Unitrap ID UNI3171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21086657..21091097 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035047 (Kri1) NP_663391 KRI1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2384899]

 
Come back to gene ENSMUSG00000035047


For any suggestions or comments, please send an email to unitrap@crg.es