Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353337
Clone ID OST353337
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353337
Sequence
AGCTAGAACAAGCTCAGAGTCGGATCTTGNNCCTGGAAAACCAGCTGGAGGAGNCAGGTCGCCACTGGGCACGAGAGAAG
CNAAACCTGGCCATTCGTCTTCAAGAGCAACAACACGGCNTTTGGACAGCCACCAAACTCCATCATCATAGACCAGCCTA
ATGCTGGAGCATCCAAGAATCGCCAGCAGCTCTCGAAACTGGAAACCTCCCTGCCCAGCTCAGACAAGAAGCTCAACAGA
CCCTCAGACTCTCAGATTGAGATCTCTAACAACCAGAAGACCTGAGACCGGGAGCAGATCTCCTTCGCCATGTGCTGGGG
ATTCACGTGCCCCCAAAGACGCCTTTAATAAAAGCTGTCAGTCAATAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57876483..57878184 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037716 (Ccdc33) NM_029212 coiled-coil domain containing 33 Gene [Source:MGI (curated);Acc:Ccdc33-001]

 
Come back to gene ENSMUSG00000037716


For any suggestions or comments, please send an email to unitrap@crg.es