Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0713
Clone ID AK0713
Vector pGT0lxr
Project sanger

Sequence tag AK0713
Sequence
CTTTCGCCCTGGATGTCAGCGAGGAAATCATACAATATGTTTTGTCAATTGAGAATGCTGAAGAAATACGAGAATATGTG
ACAGACCTTCTCCAGGGAAATGAGGGCAAAAAGGGTCAATTCATAGAAGATCTTATAACCAAATGGCAAAAGAATGATCA
AGAGTTCATCTCTGATTCCTTTCAACAGTGCTTGAGAAAAGATGAAATTTTAGATGGACAGAGATCAGTGGACCAGCTAA
AGCGGAGTAGGAGGAAAGGACGAAACAAACAGGAAGTTCCTGCATTTCCTGAACCTGACGTAGCTGTGGAGGTCAAAACA
CCTTTAGATTTGGCTAAGGCACAAGAAAGCAACAACTCCGTAAAGAAGAAGACAAGATTTGTCAATTTATATACAAGAGA
GGGACAGGACAAACTTGCAGTCCTGCTTCCTGGTCGTCACCCGTGTGATTGCCTGGGCCAGAAGCACAAACTCATCAATA
ACTGTCTGGTCTGTGGGCGGATCGTTTGTGAGCAGGAGGGTTCAGGCCCCTGCTTGTTCTGTGGCTCTTTG
Sequence Type mRNA
Unitrap ID UNI4232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65722638..65732768 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es