Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353131
Clone ID OST353131
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353131
Sequence
CCCTGATTTGCCCCGAGAAGGAAGCAGCAGGCAATGTTACCATTCACTGGGTGTACTCTGGCTCACAAAACAGAGAATGG
ACTACCACAGGAAACACACTGGTTCTGAGGGACGTGCAGCTCAGCGACACTGGGGACTATTTATGCTCCCTGAATGATCA
CCTGGTGGGGACTGTGCCCTTGCTGGTGGATGNTNNAGGAAAAGGGACACCGCTCGGCCTGTGCGTGTGGNCAGCCAGCT
GTGGAAGCCATCTGGCAGATTTAATAGCCCTGGACTCCCAGCCAGGCACCTNAGCTTAGCGGCTGCTAACCCCCTCAGAT
TCTTTTGGCAAAATAAAGTGAACTTTATTACTAAGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89693879..89694350 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027947 (Il6ra) NM_010559 interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]

 
Come back to gene ENSMUSG00000027947


For any suggestions or comments, please send an email to unitrap@crg.es