Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353130
Clone ID OST353130
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353130
Sequence
GGCCTCACGGATGAGTTTGAAGAACTGGAATTCNTAAGTNCNATCAACGTAGGCCTCACCTCCATTTCCAACTTACCAAA
GTTAAACAAACTCAAGAAGCTTGAATTAAGCGAAAACAGAATCTCAGGGGACCTGGAAGTATTGGCAGAGAAATGTCCGA
ACCTTAAGCATCTAAATTTAAGTGGCAACAAAATAAAAGATCTCAGCACAATAGAGCCGCTGAAGAAGTTAGAGAATCTC
AAGAGCCTAGACCTGTTTAACTGTGAGGTGACCAACCTGAATGCCTACCGAGAAAACGTGTTCAAGCTCCTGCCCCAGGT
CATGTACCTCGATGGCTATGACAGGGACAACAAGGAGGCCCCCGACTCCGATGTTGAGGGCTACGTGGAGGATGACGACG
AGGAAGATGAGGATGA
Sequence Type mRNA
Unitrap ID UNI4660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62219578..62221484 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032249 (Anp32a) NM_009672 acidic (leucine-rich) nuclear phosphoprotein 32 family, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3525200]

 
Come back to gene ENSMUSG00000032249


For any suggestions or comments, please send an email to unitrap@crg.es