Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST353117
Clone ID OST353117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST353117
Sequence
CACGTGAGGAAGCAATGNAGCACTTAACCCCNAAGGGTGAAGGGGAGTCACCACCCGTGAACGGAACAGATGAGGCAGCT
GNGGCTACTGGTGATGCCATCGAGCCAGCGCCCCCTAGCCAGGAAGCTGAGGCCAAGGGGGAGGTCGCCCCCAAGGAGAC
CCCCAAGAAGAAGAAGAAATTCTCTTTCAAGAAGCCTTTCAAATTGAGTGGCCTGTCCTT
Sequence Type mRNA
Unitrap ID UNI14575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129191970..129192187 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047945 (Marcksl1) NM_010807 MARCKS-like 1 Gene [Source:MGI (curated);Acc:Marcksl1-001]

 
Come back to gene ENSMUSG00000047945


For any suggestions or comments, please send an email to unitrap@crg.es