Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352973
Clone ID OST352973
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352973
Sequence
GACTGAGATAGACCTCTTGGCCCCCCGCACCTAGTACAATGGAGTAGACAAGACTTCGAGGGGAAAGAGGCTTCCCAAGA
TGACCCAGCTCATTGGCTTGACTCCCAACGCCACCCACTTACACAGGCCGCCCCGGGACTGCCAGGAACTCTTCCAAGAA
GGGGAGCCGGCACAGTGGACTTTTCCAGATCCAGCCTCTGGGGTCTCCACCATTTTTGGTCAACTGTGAGATGACTTCAG
ATGGAGGCTGGACAGTGATTCAGAGACGCCTGAACNGGCTCTGTGGACTTCAACCAGTCCTGGGAAGCCTACAAGGATGG
CTTCGGAGATCCCCAAGGCGAGTTCTGGCTGGGCCTGGAAAAGATGCACAGCATCACAGGGAACCGAGGAAGCCAATTGG
CTGTGCAGCTCCAGGACTGGGATGGCAATGCCAAATTGCTCCAATTTCCCATCCATTTGGGGGGGNGAGGACACAGCCTA
CAGCCTGCAGCT
Sequence Type mRNA
Unitrap ID UNI20756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33914023..33917597 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002289 (Angptl4) NM_020581 angiopoietin-like 4 Gene [Source:MGI Symbol;Acc:MGI:1888999]

 
Come back to gene ENSMUSG00000002289


For any suggestions or comments, please send an email to unitrap@crg.es