Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0374
Clone ID AK0374
Vector pGT0lxr
Project sanger

Sequence tag AK0374
Sequence
CAGGTCACTGGAGTAGGCTATAATCAGTTTTGTGAAGGGATTGTTGAAGGAGGTGTTGTTCATGGATTTTATAACCCAGC
TGTTAGCAGAATTGTTGAGGCAGGCTGTGTGTGCAATGATGCTGTAATTAGGAACAACACTCTGATGGGAAAGCCAACTG
AAGGAGCTTTAATCGCTCTTGCTATGAAGATGGGTCTTGATGGACTGCAACAAGACTACATCAGGAAAGCTGAATACCCT
TTTAGTTCTGAGCAGAAGTGGATGGCTGTTAAGTGTGTGCACCGAACACAGCAG
Sequence Type mRNA
Unitrap ID UNI4231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105341671..105345374 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032570 (Atp2c1) NM_175025 ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]

 
Come back to gene ENSMUSG00000032570


For any suggestions or comments, please send an email to unitrap@crg.es