Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352929
Clone ID OST352929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352929
Sequence
CTCCCGGTGAGGGGGCCAATATATTAAGCTGGCATGTCCAGACNGNTNCATNTGACCNNGAGNGACNNTAACCTGTAGGA
NNCTGAAGGNCGATTCTATCTCATGGGGAAGGAAAATAGTCATAATTGCTCCCTGGACATCAGAGATGCACAGAAAATCG
ACACAGGGACGTACTTCTTCAGATTGGATGGTTCTGTGAAATACAGTTTTCAGAAGTCAATGCTCTCTGTGCTTGTGATA
GCTCTGACTGAGGTCCCTAACATCCAAGTCACATCTACCCTGGTGTCTGGCAATTCTACCAAACTGCTCTGTTCTGTGCC
CTGGGCCTGTGAGCAGG
Sequence Type mRNA
Unitrap ID UNI20759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 50607147..50607633 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039013 (Siglec5) NM_145581 sialic acid binding Ig-like lectin E Gene [Source:MGI (curated);Acc:Siglec5-003]

 
Come back to gene ENSMUSG00000039013


For any suggestions or comments, please send an email to unitrap@crg.es