Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352640
Clone ID OST352640
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352640
Sequence
ACTGAGGGCAGTTCCTCCAGAAGTGCAGNCTCTGCGAGCNTGNNNNCTGAGCTGGTCGNANAGGCTGAGGNCCGATGCCT
TCGAGTGATTAATCCTGATGTGGGCTCTGGCCTCAGTCACTTGCTACCACCAGCCATGTCTGCCCGCTTCCGCCTGGCCA
TGAGTCTGGCCCAGGCCTGCATGGACCTGGGCTATCCCTTGGAGCTTGGCTATCAGAACTTCCTCTATNCCAGNGAGCCT
GACCTTCGAGATCTGCTTCTTTTCTTGGCTGAGCGANTACCCANCGATGCCTCTGAGGACGCAGACCAGNCTGCAGGTGA
CTCGGCTATTTTCCTTNNGGCCATTGNGAGCCAAATCCGGNACCAGNTGGCCCTGCCCTGGGTCNCACCTGNCCTTCGAA
CTCCCAAGGTGCANTGNCTCCAGGGCTNAACCCTCCNGCAGCCGTTCCACTCCAGCAGGTTGGTTCTACCTGAGAT
Sequence Type mRNA
Unitrap ID UNI20770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7176576..7181465 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031143 (Ccdc22) NM_138603 coiled-coil domain containing 22 Gene [Source:MGI (curated);Acc:Ccdc22-001]

 
Come back to gene ENSMUSG00000031143


For any suggestions or comments, please send an email to unitrap@crg.es