Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352416
Clone ID OST352416
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352416
Sequence
ACTGAGCTGAAGGATGGTGGCAAGGCATCTCAGGCACATGTCAGAATAGGCGACGTGGTTCTCAGCATCGATGGGATCAG
TGCACAGGGAATGACGCATCTTGAAGCCCAGAACAAGATTAAGGCTTGTACGGGCTCCTTGAATATGACTCTACAAAGAG
CTTCAGCTGCAGCCAAGAGTGAGCCGGTTTCCTGTCCAGAAGGGTGAACCTAAGGAAGTAGTTAAGCCTGTGCCCATTAC
ATCTCCTGCTGTACCCAAAGANACTTGCNCTACCAACATGGCCTACAATAAAGCACCACGGCCCTTTGGTTCTGTGTCTT
CACCAAAAGTCACATCCATCCCATCACCATCGNCTGCGTTCACCCCAGCCCATGCCGNCACTTCATCACATGCTTGCCCC
ACACCTGTGGCCGCTGCCACTCCCCTCCACCTCTCTGCATCCGGACTGCATGTTAGTGCCAATCTTAGTGCTGACCAGTG
TTCATCTCCACCGAACACTGNTAAACCTGCAGTTAATC
Sequence Type mRNA
Unitrap ID UNI7107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 141975191..142015851 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028273 (Pdlim5) NM_019809 PDZ and LIM domain 5 Gene [Source:MGI Symbol;Acc:MGI:1927489]

 
Come back to gene ENSMUSG00000028273


For any suggestions or comments, please send an email to unitrap@crg.es