Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352391
Clone ID OST352391
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352391
Sequence
TCCAGCATCAACCAGNACCGGCTCGAGTTCCACTTCTCTGGTAGAATGGCCAGCGGCATGGAGGTCCGGCAGACCCGCTT
CATGTTCTTCGTACAGTTCCCCCACAATGCCACCCAGACCATGAATATAAGAGTTCTTGTGCTAAGACCATATGACACCA
A
Sequence Type mRNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126794720..126794880 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es