Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AJ0459
Clone ID AJ0459
Vector pGT0lxr
Project sanger

Sequence tag AJ0459
Sequence
CNAGCCGTAAACAACATGGCGAAGGCCGGCGAGAAAAGTGTTGGTGGCGGCAAGCGAGGCTTGAAGAGGAAAGCTGCCGC
TGAAGAGCCTCAAGAGGCTGCGGCCGCGAGCGATGGGACGGCGGAGAGCGGGGTGCAGCCCGCGAAAGCGGCCGCCTTCC
CCCCGGGCTTCAGTATCTCGGAGATTAAGAACAAGCAGCGGCGACACTTGATGTTCACGCGGTGGAAACAGCAGCAGCGG
AAGGAAAAGTTGGCAGCTAAGAAAAAACTTAAAAAGGAGAGAGAGGCTCTTGGCGATAAGGCTCCACCAAAGCCTGTTCC
CAAGACCATTGACAACCAGCGCGTTTACGACGAGACCACAGTAGACCCCAATGATGAAGAG
Sequence Type mRNA
Unitrap ID UNI4256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146180690..146184373 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028187 (Bxdc5) NP_081608 brix domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917535]

 
Come back to gene ENSMUSG00000028187


For any suggestions or comments, please send an email to unitrap@crg.es