Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352198
Clone ID OST352198
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352198
Sequence
CCTGGAGTGGCTGTGCTGGAGTGGCAGGAGAAGCGTAGACCCTTCTCGGACTCCACAGCTTTAATACTGGGGAGTAGGGT
GCAGTTTCACTAGTAGAAGCCACCCCTCCTCCTGCCTNCCAGGTCAGCTGCTTCTGAGCAGGGGCTNCTGGCGACTGTAC
CTGCCCAGCAACCTGGAGGACAGCGTCCTGAGGTCTNCCAAGGATGGNCCTTGCCCCTGTATGNTTCCCTAATAAAGCCT
TTTAACCCAAAAAAA
Sequence Type mRNA
Unitrap ID UNI7903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52118438..52122773 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038502 (Ptov1) NM_133949 prostate tumor over expressed gene 1 Gene [Source:MGI (curated);Acc:Ptov1-001]

 
Come back to gene ENSMUSG00000038502


For any suggestions or comments, please send an email to unitrap@crg.es