Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352131
Clone ID OST352131
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352131
Sequence
GACTGAGGTCCTGGCCTTGCTGGACTGNGGGTCCTCCTACCCACAGCTGGATCTCTGCTGCGCCTTCCTACTCTACTGGC
TNGCTTGGTCTTCCCTCCCCGGACAGGGGCCGCCATGNGATCTGATGAGATAGTGTATGTGAAAGCCTTTGTNAACNGNA
NGCGCACANGCGANCGCCANGAGGACACATATGGNNAGGANACACCAGGACGNCTGGCTGAAGAGGAAGACCCANAGGAT
AGATCTGGTTCTGAAGACTCAGAAGATGGAGTAGAAATGGCNACGGCAGCAATAGAGACTCAAGGGAAGCTTGAAGCTAG
CAGNGTACCCAATTCTGATGATGATGCAGAGAGCTGCCCCATT
Sequence Type mRNA
Unitrap ID UNI20794

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148418377..148423511 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038611 (Phrf1) NP_001074587 PHD and ring finger domains 1 Gene [Source:MGI Symbol;Acc:MGI:2141847]

 
Come back to gene ENSMUSG00000038611


For any suggestions or comments, please send an email to unitrap@crg.es