Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352102
Clone ID OST352102
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352102
Sequence
GCTCTGCTGCCTGCATGCAGACATGCTGAGCTCTCTGGGCCCCAAAGAAGCCAAGAAGGCCTTCCTTGACTTCTATCACA
GTTTCCTGGAGAAGACTGCGGTGAGATACCTCCCAGCTGCCCCTGTCCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25697075..25697203 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es