Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST352072
Clone ID OST352072
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST352072
Sequence
ACTGAGCCCGGGTCGAGGAAGATGAGCCGGCCTTGGAAGAGCTGGAGCAGCGGGAAGTGTTGGTGCTGGGCTTGGATGGC
TCAGGGAAAAGCACGTTCTTGCGATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54677109..54677208 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025870 (Arl10) NM_019968 ADP-ribosylation factor-like 10 Gene [Source:MGI Symbol;Acc:MGI:1930788]

 
Come back to gene ENSMUSG00000025870


For any suggestions or comments, please send an email to unitrap@crg.es