Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351949
Clone ID OST351949
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351949
Sequence
GACTGAGTGATTTTCTCATTCTTCCTGGGTATATCGACTTCACTGCAGATCAGGTGGACTTGACGTCTGCTCTAACTATT
TTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108463363..108463949 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062867 (Impdh2) NM_011830 inosine 5'-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:109367]

 
Come back to gene ENSMUSG00000062867


For any suggestions or comments, please send an email to unitrap@crg.es