Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351924
Clone ID OST351924
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351924
Sequence
GACTGAGGAAACCCAGCGTTTGCTGGCAGACCAGTTCCTGGCATTAAAGCAGAACCAGATGAGAGCAACGCCCGTTATTT
TCATGTGGTCATTGCTGGCCCCCAGGATTCCCCCTTTGAGGGAGGGACTTTTAAACTTGAACTATTCCTTCCAGAAGAAT
ACCCAATGGCAGCACCTAAAGTACNGTTTCATGACCAAAATTTATCATCCTAATGTAGACAAGTTGGGAAGAATATGTTT
AGATATTTTGAAAGATAAGTGGTCCCCAGCACTGCAGATCCGCACAGTTCTGCTATCAATCCAGGCTTTGTTAAGTGCTC
CTAATCCAGATGATCCATTAGCAAATGATGTAGCCGAGCAATGGAAGACCAACGAAGCCCAAGCCATAGAAACAGCGAGA
GCATGGACTAGGCTATATGCCATGAACAATATTTAAGTCGATCAGATCATCGAGTGTACACCACTTCTCCTGTTCTGCCA
AGACTTCTTCCTTTTTTTGTTTGCATTTAATGGACACAGTCTTAGAAACATTACAGAATAAAAGCCCAGGC
Sequence Type mRNA
Unitrap ID UNI15833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 95003837..95005061 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074781 (Ube2n) NP_542127 ubiquitin-conjugating enzyme E2N Gene [Source:MGI Symbol;Acc:MGI:1934835]

 
Come back to gene ENSMUSG00000074781


For any suggestions or comments, please send an email to unitrap@crg.es