Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AJ0163
Clone ID AJ0163
Vector pGT0lxr
Project sanger

Sequence tag AJ0163
Sequence
TAGGCCCACAGAGTTTCAGCGAATTCTACCCTGTGTTTTCAGAGGTGTTATGAAGGCGAGAGGTATCCAGTAGTGATGTC
CATTTATCTTGCTGTCATGGGTCGAGTCTTACTCCAGAATACCAGCTTCTTTTCTTCACTTCTTAATGAGATGGGACACG
AGTTTAATCAGGAGATGGACCAGCTTTTAGGAAATGTGATTGAAATGTGGGTCGATCGAATGGACAACATCACACAGCCC
GAAAGAAAGAAACTCTCAGCTTTGGCTTTGCTTTCTCTTCTGCCTTCTGATAATAGTGTTATCCAAGATAAATTTTGTGG
AATTATAAATATCTCAGTGGAGGCTCTTCATGATGTCATGACAGAAGACCCTGAAACAAGAACTTACAAAGATTGTATGT
TGATGTCTCAACATGAGGAACCGAAAGTAACAGAAGATGAAGAGCCACCCACAGAACAAGACAAGAGGAAAAAGATG
Sequence Type mRNA
Unitrap ID UNI4265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107602288..107638382 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es