Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351731
Clone ID OST351731
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351731
Sequence
GACTGAGTGCCCTGGCTTCCCACCCGNTCAGNCATCGGGCCTGCTCGGGATGCAAATGATCCTGTGGATGATCGCCATGC
CCCACCAGGGAAGAGAACTGTGGGGGACCAGATGAAGAAAAATCAGGCGGCTGATGATGATGATGAAGATCTGAATGATA
CCAACTACGATGAGTTTAATGGCTATGCNTGGGAGCCTCTTCTCAAGTGGGCCCTATGAAAAAGATGATGAGGAAGCAGA
TGCTATTTATGCAGCTCTGGATAAAAGGATGGATGAGAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181342823..181350792 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es