Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351704
Clone ID OST351704
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351704
Sequence
GACTGAGGTGGGGTCTTTCACACAACGAAGTTCATCCCGTCAGGCCGACCGGGAGCAGGNCNAGCGACGGNCATGGCGGC
TCTAGGCTCCAGCAGNCAGAATGTCACCGAGTACNNNGNNCGAGTCCCCAAGAACACAGCCAAAAAGATACAACATAAAT
GGCATTTTAATGCANNCGATAAAGTCAACATTTGCATACCTGGAACCAGGCACNGGNTGGAGCAGAGATCTGAGCAACAA
GAAGATTTACCAGGAAGAAGAGATGCCAGAGTCCGGTGCAGGCAGNGAATTCAACCGCAAGCTTAGGGAGGAGGCGCGCC
GGAAGAAGTATGGCATTGTCCTAAAGGAGTTTCGGCCTGAGGATCAGCCTTGGCTACTCCGTGTCAATGGCAAATCAGGA
CGGAAGTTCAAAGGCATTAAGAAAGGCGGGGTAACAGAGAACACAGCCTACTACATCTTCACACAGTGTGCTGATGGTGC
CTTTGAGGCTTTCCCTGTACAGAACTGGTACAATT
Sequence Type mRNA
Unitrap ID UNI20807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57146470..57150596 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002658 (Gtf2f1) NM_133801 general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]

 
Come back to gene ENSMUSG00000002658


For any suggestions or comments, please send an email to unitrap@crg.es