Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351200
Clone ID OST351200
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351200
Sequence
CCTATGATGACGTGCATGTGAACTTTACTCAGGAAGAATGGGCTTTGCTGGATCCTTCTCAGAAGAGTCTCTACAAAGGT
GTGATGCTAGAGACCTATAGGAATCTCACAGCTATAGGTTACATTTGGGAAGAACATACAATTGAAGACCATCTTCAAAC
TTCTAGAAGTCATGGAAGGTACNTTTTCTTCTGCAACCTGATGAAAAAATTCCTATGAAGAAAGTTTAACGTGTGCTACA
AGTAGTAAAGAAAACCACTAGGGTACAATAAGCACTGATTTCAGTCATGGATGTTTACTGAATTTCATAAAATCATATAT
GTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI6522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177101622..177569341 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es