Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST351024
Clone ID OST351024
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST351024
Sequence
GTCTATGATTTGAGGTGTGACCCTGCTAGTGCAGNTGAAGGCATAAAACCAAGGAAAAGAAAGACTTTTGCTTTGCCTGG
AATAATTAAAAAGGAAAAGGACGCAGAATCTGTGGAATGTCCTGATGCAGATTCGCTTAATATTCCAGATGTAGATGAAG
AAGGTTTCAGTATTAAACCAGAAGCAAATCANAATGATACCAAAGAGAACCATTTCTACTCATCCAGNGACTCTGACTCT
GAAGATGAAGAACCAAAGAGGTACCGGATAGAGATCAAGCCCGCGCATCCAAATAACTTGCATCACACAATGGCTTCTTT
GGATGAACTGAAAGCATCCATAGGGAATATAACATTGNCCCCAGCAGNNATCTGGTTTCCTTCCATAGCT
Sequence Type mRNA
Unitrap ID UNI20822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99525034..99534494 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041685 (Fcho2) NP_766179 FCH domain only 2 Gene [Source:MGI Symbol;Acc:MGI:3505790]

 
Come back to gene ENSMUSG00000041685


For any suggestions or comments, please send an email to unitrap@crg.es