Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350982
Clone ID OST350982
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350982
Sequence
GAGGCCATCCAAACCGTACCTAAAACTACAGTCTAGCTTCAAGCATCAAATTACGTGGCACTTGAGAAACGTAGTGCTTC
CCTGACGGCCGTCGATCTTGCAGAGGAAGGATCCTAGCCTGGGCTTTAGACGCTTGCCAGCAGCACTCCATGGCCCTCAC
GATGCTGAATGGTCTACTCATTAAGGACTCCAGCCCACCTATGCTGCACCAGATTAGCAAGACTCCTCAGCTAGATGCCT
TCAACTACCAAAGCTGCTTCATGCAAGACCTCTTTGCTCATTTCCCTGAGGTCTTATTTATCCACCGGACCTATAACCCA
AGAGGCAAGGTGTTGTACACCTTCCTGGTAGATGGACCCCGGGTCCAGGTTGAGGGTCCTCTTGCCCGAGCTGTGTACTT
TGCCATCCCTACCAATGAAGATGCCAGAGGCCTGGCCCAGATGTTNCANGNGTTCAAAAAAGTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164650184..164650646 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es