Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0535
Clone ID AH0535
Vector pGT0lxr
Project sanger

Sequence tag AH0535
Sequence
TGGTTTTTTTTTGGGATCGAGTCCGGTAGCGGTGGCGGGTATCTGCTGGCGGTTTGGCTAGGTTTCTGCGGTCGCGTCAT
TTTCTCCGCAGTGCCCAGCATCACTATTTCATGGTGTGTGAAGATAACCCAGAACATTGAAGACGTTTCTAAGGAGATAT
TCAGAGGATGCTCTAGGGAAGATCTGAGTACTGAAGAAAGGGAGAATCATGGACCAGAACAACAGCCTTCCACCTTATGC
TCAGGGCTTGGCCTCCCCACAG
Sequence Type mRNA
Unitrap ID UNI4273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15636904..15640092 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014767 (Tbp) NP_038712 TATA box binding protein Gene [Source:MGI (curated);Acc:Tbp-001]

 
Come back to gene ENSMUSG00000014767


For any suggestions or comments, please send an email to unitrap@crg.es