Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350787
Clone ID OST350787
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350787
Sequence
ACCTGTCAACCTTTTCCACCNGACANAGCGAAAGAGATTATAATGGGTTTACAGCAGCCTGCNCTNTTNNGTAACATGGN
TNCCCATTGTCCATCACGACNCTGGACTGCGAAACACCTTTCGAAGGTCTTGGAGGGCAAGCAGATACNGGTTCAGAATG
GGCCTGAGAGGCACAGGCACAGTTCCTCAGTATGAAACCGAATGTAGTTATGTGGATGCGACGCTCGAGGAGTTTTTGAC
CTGGAACTGTGACCAGTCTAGTATCTCTGGACCATTCAAAGATTATGAACATTCTAAATTCTGGGCTTACGCTGACTATA
AGTATTTTGTTACTCTGTTTGAGGACAAGACAGATGTTTTCCAGGAGGTGGTGTGGTCNGACTTTGGGTTTCCTGGAAGA
AATGGACAAGAAAGTACACTGTGGATCGGGTCCTTTGGAGCCCACACTCCCTGCCATCTGGACTCCCTATGGCTGAC
Sequence Type mRNA
Unitrap ID UNI5309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35787280..35814113 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es