Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0440
Clone ID AH0440
Vector pGT0lxr
Project sanger

Sequence tag AH0440
Sequence
TTTTTTTTGAGCAGCAGCGGTCGCCATCTTGGTCCGAGACCCGCCGAACTTAGGAAATTAGTCTGAACAGGCCTTCTTGC
ATCGAATGAACCAATGTGCAGCAGCAAAGGTTGATAAAAATGTGACGGAGGAAACAGTGAAGATGTTATTCTCCAATATC
GAGGAGATCCTCATCGTTCATAAGGAGTTCTTGAAAGTTGTAGAAGAATGCTTATATCCGGAACCCAGTGCTCAGCAGGA
AGTGGGAGCCTGCTTCCTTCACTTTAAGGACAAGTTTCGTATCTATGATGAATATTGCAGCAACCATGAAAAGGCACAAA
AATTGCTTCTTGAACTGAACATAATAAGAACAATCCGGACATTTCTTATG
Sequence Type mRNA
Unitrap ID UNI4278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11051403..11058196 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]

 
Come back to gene ENSMUSG00000048960


For any suggestions or comments, please send an email to unitrap@crg.es