Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350667
Clone ID OST350667
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350667
Sequence
TCCAAATCTTCACACTTGCCTTCTTCCCAGCAGCAATATGGCTCTTTCTTCAGCTCTTATCAGTCACATCCATCAACGAG
TGGCTTTTAAAAGGTCTGCAGACAGTAGGTTGCATGCCACCCCCTGTGTCTTCTGCCGNGATTTTAACCAAGGCAGNTGG
GNGGAAATGAGGTGAGTCACNGGGGATAACCGGAATTTAATCGGGGGGGCTGGGGCTTTGGGATGGGGAAAGAA
Sequence Type mRNA
Unitrap ID UNI20548

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81049104..81055115 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es