Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350481
Clone ID OST350481
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350481
Sequence
TCTTACAGGCCAAGTGGATGCTATTTCATTNGGCTCCTTTTCATGNATAACAGGACAGTGCTAACTGGAATTCTCTAAGT
ACCCTTTAAATACAGCAGAGTAAATGATACCATATATTCCCTAAGGATAAACA
Sequence Type mRNA
Unitrap ID UNI20838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 52059144..52059273 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019861 (Gopc) NM_053187 golgi associated PDZ and coiled-coil motif containing Gene [Source:MGI Symbol;Acc:MGI:2149946]

 
Come back to gene ENSMUSG00000019861


For any suggestions or comments, please send an email to unitrap@crg.es