Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0287
Clone ID AH0287
Vector pGT0lxr
Project sanger

Sequence tag AH0287
Sequence
TGAAGACTATGATGTCCCAGAGGGGGTAGAAACTGTGATAGAGCAGCTACTGGTTGGGTTGAAGGACAAGGACACTGTGG
TGCGGTGGTCTGCAGCGAAAGGAATTGGTAGGATGGCTGGAAGGCTTCCCAGAGAGCTGGCCGATGATGTGGTGGGGTCT
GTGTTGGACTGTTTCAGTTTTCAGGAGACGGATAAGGCATGGCATGGTGGATGTCTGGCATTGGCAGAGCTGGGTAGACG
AGGCCTGTTGCTACCATCCAGACTCTCAGAGGTTGTCACGGTGATCCTGAAGGCCCTTACCTACGATGAGAAGCGGGGTG
CCTGCAGCGTTGGGGCCAATGTCAGGGATGCTGCCTGTTATGTGTGCTGGGCTTTTGCACGTGCCTATGAACCTCAGGAG
TTGACACCTTTTGTGACTGCCATTTCAAGTGCCCTGGTCATTGCTGCTGTATTTGACCGAAATGGAANCNTTTTGGGGGG
GA
Sequence Type mRNA
Unitrap ID UNI4283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121358411..121411572 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es