Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350154
Clone ID OST350154
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350154
Sequence
TGAGGTGGGGTCTTTCACTGCGAAGAACTGGGTGAGATGTGGTCTGAGCAATCTGCCAAAGATAAACAACCGTATGAGCA
GAAAGGGGCTAAACTAAAGGAGAAGTATGAAAAGGATATTGCTGCATACCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGA
AGGGTCCTGGTAGGCCAACAGGCTCAAAGAAGAAGAACTGAACCA
Sequence Type mRNA
Unitrap ID UNI20845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59992163..59992852 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054717 (Hmgb2) NM_008252 high mobility group box 2 Gene [Source:MGI Symbol;Acc:MGI:96157]

 
Come back to gene ENSMUSG00000054717


For any suggestions or comments, please send an email to unitrap@crg.es