Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST350065
Clone ID OST350065
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST350065
Sequence
GGAATGGGTACGGCCTCTGTAAAATCGATCGAGAGGGCAAACCACNGGAAGGTGGTTGGTTGCAGTTGC
Sequence Type mRNA
Unitrap ID UNI2544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 59397118..59397184 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067038 (AC139040.8) NP_035425 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23505394..23505460 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125730780..125730846 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069862 (AC163617.5) NP_035425 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 63269643..63269709 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078087 (Rps12) NP_035425 ribosomal protein S12 Gene [Source:MGI Symbol;Acc:MGI:98105]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 121881529..121881595 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082830 (CR628363.12)  

 
Come back to gene ENSMUSG00000082830


For any suggestions or comments, please send an email to unitrap@crg.es