Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST349607
Clone ID OST349607
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST349607
Sequence
CTGGTTCTGACAGTGGCACAACAGCGGTGGTGGCTCTGATCAGAGGGAAGCAGTTGATTGTGGCCAATGCAGGAGACTCT
CGCTGTGTGGTGTCCGAGGCTGGCAAAGCTTTAGATATGTCCTATGACCACAAACCAGAGGATGAAGTGGAGCTGGCACT
GCATCAAGAATGCTGGTGGCAAGGTCACCATGGATGGACGAGTCAATGGAGGCCTCAACCTCTCCAGGGCCATTGGAGAC
CACTTCTACAAGAGAAACAAAAACTTGCCACCCCAGGAACAGATGATTTCTGCCCTTCCTGACATCAAGGTGCTGACTCT
CACTGATGACCATGAATTCATGGTCATTGCTTGTGACGGCATCTGGAATGTGATGAGCAGCCAGGAGGTTGTAGACTTTA
TTCAATCAAAGATCAGTCAACGTGATGAAAACGGNAGAGCTTCGGTTATTGNCATCCATTGNGGAAGAGCTGCTGGATCA
G
Sequence Type mRNA
Unitrap ID UNI20857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30784696..31507059 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029147 (Ppm1g) NM_008014 protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform Gene [Source:MGI Symbol;Acc:MGI:106065]

 
Come back to gene ENSMUSG00000029147


For any suggestions or comments, please send an email to unitrap@crg.es